Gene Page: NIPA2

Summary
GeneID  81614
Symbol  NIPA2
Synonyms  MGC5466
Description  non imprinted in Prader-Willi/Angelman syndrome 2
See related  HGNC:17044|MIM:608146|Ensembl:ENSG00000140157|HPRD:16290|
Locus tag  -
Gene type  protein-coding
Map location  15q11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.578 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-30-3p67731Ahsa-miR-30a-3pCUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3pCUUUCAGUCGGAUGUUUACAGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.