|
GeneID |
81617
|
Symbol |
CAB39L
|
Synonyms |
FLJ12577|MO25-BETA|MO2L|RP11-103J18.3|bA103J18.3
|
Description |
calcium binding protein 39-like |
See related |
HGNC:20290|MIM:612175|Ensembl:ENSG00000102547|HPRD:12993| |
Locus tag |
- |
Gene type |
protein-coding |
Map location |
13q14.2-q14.3 |
|
|
|
Gene set name |
Method of gene set |
Evidence |
Info |
Expression | Expression | P value: 2.161 | | Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia] | Click to show detail |
|
|
General Gene Expression (microarray) ? |
|
|
|
Gene Expression in Brain Regions (new) |
|
|
Top co-expressed genes in Brain Regions (new) |
|
Gene | Pearson's Correlation | Spearman's Correlation | | |
Top 10 positively co-expressed genes |
ALK | 0.77 | 0.80 | | |
LAMB3 | 0.74 | 0.78 | | |
GJD2 | 0.74 | 0.77 | | |
CDH8 | 0.73 | 0.74 | | |
C4orf44 | 0.73 | 0.72 | | |
KIF17 | 0.73 | 0.79 | | |
PWWP2B | 0.73 | 0.74 | | |
CACNA2D3 | 0.72 | 0.71 | | |
CYB561 | 0.71 | 0.80 | | |
EPHA10 | 0.71 | 0.73 | | |
Top 10 negatively co-expressed genes | KCNMB3 | -0.31 | -0.37 | | |
NEUROD6 | -0.31 | -0.13 | | |
SLA | -0.30 | 0.02 | | |
NHSL1 | -0.30 | -0.17 | | |
SCUBE1 | -0.30 | -0.17 | | |
PCSK9 | -0.29 | -0.18 | | |
SATB2 | -0.29 | -0.04 | | |
DACT1 | -0.29 | 0.02 | | |
KLHL1 | -0.29 | 0.00 | | |
ZEB2 | -0.29 | -0.13 | | |
|
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0005488 | binding | IEA | | - |
GO:0005515 | protein binding | IPI | | 17353931 |
|
|
|
|
|
miR-342 | 2076 | 2082 | 1A | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|