Gene Page: TSC22D4

Summary
GeneID  81628
Symbol  TSC22D4
Synonyms  THG-1|THG1
Description  TSC22 domain family, member 4
See related  HGNC:21696|MIM:611914|Ensembl:ENSG00000166925|HPRD:18231|
Locus tag  -
Gene type  protein-coding
Map location  7p21-p15
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0152 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIEA-
GO:0005515protein bindingIPI16189514 |16713569 
GO:0016564transcription repressor activityNAS10488076 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentNAS-
GO:0006350transcriptionIEA-
GO:0006970response to osmotic stressIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmIDA18029348 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ABLIM1ABLIM | DKFZp781D0148 | FLJ14564 | KIAA0059 | LIMAB1 | LIMATIN | MGC1224actin binding LIM protein 1Two-hybridBioGRID16189514 
C16orf48DAKV6410 | DKFZp434A1319chromosome 16 open reading frame 48Two-hybridBioGRID16189514 
CCDC33FLJ23168 | FLJ32855 | MGC34145coiled-coil domain containing 33Two-hybridBioGRID16189514 
CCDC42FLJ32734coiled-coil domain containing 42Two-hybridBioGRID16189514 
CCNKCPR4 | MGC9113cyclin KTwo-hybridBioGRID16189514 
CDC23APC8cell division cycle 23 homolog (S. cerevisiae)Two-hybridBioGRID16189514 
CDK5R1CDK5P35 | CDK5R | MGC33831 | NCK5A | p23 | p25 | p35 | p35nck5acyclin-dependent kinase 5, regulatory subunit 1 (p35)Two-hybridBioGRID16189514 
CKS2CKSHS2CDC28 protein kinase regulatory subunit 2Two-hybridBioGRID16189514 
FRMD6C14orf31 | EX1 | MGC17921 | Willin | c14_5320FERM domain containing 6Two-hybridBioGRID16189514 
FXR2FMR1L2fragile X mental retardation, autosomal homolog 2Two-hybridBioGRID16189514 
GNB2L1Gnb2-rs1 | H12.3 | HLC-7 | PIG21 | RACK1guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1Two-hybridBioGRID16189514 
GORASP2DKFZp434D156 | FLJ13139 | GOLPH6 | GRASP55 | GRS2 | p59golgi reassembly stacking protein 2, 55kDaTwo-hybridBioGRID16189514 
LNX1LNX | MPDZ | PDZRN2ligand of numb-protein X 1Two-hybridBioGRID16189514 
MAD2L1HSMAD2 | MAD2MAD2 mitotic arrest deficient-like 1 (yeast)Two-hybridBioGRID16189514 
MTHFSFLJ30410 | HsT192685,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)Two-hybridBioGRID16189514 
NIF3L1ALS2CR1 | CALS-7 | MDS015NIF3 NGG1 interacting factor 3-like 1 (S. pombe)Two-hybridBioGRID16189514 
NOC4LMGC3162 | NOC4nucleolar complex associated 4 homolog (S. cerevisiae)Two-hybridBioGRID16189514 
NRBP1BCON3 | FLJ27109 | FLJ35541 | MADM | MUDPNP | NRBPnuclear receptor binding protein 1Two-hybridBioGRID16189514 
PIH1D1FLJ20643 | NOP17PIH1 domain containing 1Two-hybridBioGRID16189514 
PIN1DOD | UBL5peptidylprolyl cis/trans isomerase, NIMA-interacting 1Two-hybridBioGRID16189514 
PSMA1HC2 | MGC14542 | MGC14575 | MGC14751 | MGC1667 | MGC21459 | MGC22853 | MGC23915 | NU | PROS30proteasome (prosome, macropain) subunit, alpha type, 1Two-hybridBioGRID16189514 
SAT1DC21 | KFSD | SAT | SSAT | SSAT-1spermidine/spermine N1-acetyltransferase 1Two-hybridBioGRID16189514 
SYT17-synaptotagmin XVIITwo-hybridBioGRID16189514 
TEX11TGC1 | TSGA3testis expressed 11Two-hybridBioGRID16189514 
TSC22D1DKFZp686O19206 | MGC17597 | RP11-269C23.2 | TGFB1I4 | TSC22TSC22 domain family, member 1-HPRD10488076 
UBLCP1CPUB1 | FLJ25267 | MGC10067ubiquitin-like domain containing CTD phosphatase 1Two-hybridBioGRID16189514 
ZMYND10BLU | FLUzinc finger, MYND-type containing 10Affinity Capture-Western
Two-hybrid
BioGRID16189514 
ZNF580-zinc finger protein 580Two-hybridBioGRID16189514 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/5062026m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-32073801A,m8hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.