Gene Page: FZD9

Summary
GeneID  8326
Symbol  FZD9
Synonyms  CD349|FZD3
Description  frizzled homolog 9 (Drosophila)
See related  HGNC:4047|MIM:601766|Ensembl:ENSG00000188763|HPRD:03460|
Locus tag  -
Gene type  protein-coding
Map location  7q11.23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
GO:0004930G-protein coupled receptor activityIEA-
GO:0004926non-G-protein coupled 7TM receptor activityIEA-
GO:0042813Wnt receptor activityTAS9147651 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007405neuroblast proliferationIEAneuron (GO term level: 8)-
GO:0007399nervous system developmentTASneurite (GO term level: 5)9147651 
GO:0007186G-protein coupled receptor protein signaling pathwayIEA-
GO:0016055Wnt receptor signaling pathwayIEA-
GO:0007611learning or memoryIEA-
GO:0007275multicellular organismal developmentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneTAS9147651 
GO:0005886plasma membraneTAS9147651 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
MDFII-MF | I-mfaMyoD family inhibitorTwo-hybridBioGRID16189514 
WNT1INT1wingless-type MMTV integration site family, member 1-HPRD9147651 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
KEGG_WNT_SIGNALING_PATHWAY 151112All SZGR genes in this pathway
KEGG_MELANOGENESIS 10280All SZGR genes in this pathway
KEGG_PATHWAYS_IN_CANCER 328259All SZGR genes in this pathway
KEGG_BASAL_CELL_CARCINOMA 5544All SZGR genes in this pathway
PID_WNT_SIGNALING_PATHWAY 2823All SZGR genes in this pathway
REACTOME_SIGNALING_BY_GPCR 920449All SZGR genes in this pathway
REACTOME_CLASS_B_2_SECRETIN_FAMILY_RECEPTORS 8858All SZGR genes in this pathway
REACTOME_GPCR_LIGAND_BINDING 408246All SZGR genes in this pathway
HAMAI_APOPTOSIS_VIA_TRAIL_DN 186107All SZGR genes in this pathway
SHETH_LIVER_CANCER_VS_TXNIP_LOSS_PAM4 261153All SZGR genes in this pathway
SHEPARD_CRUSH_AND_BURN_MUTANT_DN 185111All SZGR genes in this pathway
HANN_RESISTANCE_TO_BCL2_INHIBITOR_DN 4831All SZGR genes in this pathway
SMID_BREAST_CANCER_RELAPSE_IN_BONE_DN 315197All SZGR genes in this pathway
SMID_BREAST_CANCER_BASAL_UP 648398All SZGR genes in this pathway
EHLERS_ANEUPLOIDY_DN 128All SZGR genes in this pathway
GRADE_COLON_VS_RECTAL_CANCER_DN 5636All SZGR genes in this pathway
VART_KSHV_INFECTION_ANGIOGENIC_MARKERS_UP 165118All SZGR genes in this pathway
VANTVEER_BREAST_CANCER_ESR1_DN 240153All SZGR genes in this pathway
MARTENS_TRETINOIN_RESPONSE_UP 857456All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1453143201Ahsa-miR-145GUCCAGUUUUCCCAGGAAUCCCUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.