Gene Page: FAM57B

Summary
GeneID  83723
Symbol  FAM57B
Synonyms  DKFZp434I2117|FP1188
Description  family with sequence similarity 57, member B
See related  HGNC:25295|Ensembl:ENSG00000149926|HPRD:13156|
Locus tag  -
Gene type  protein-coding
Map location  16p11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005783endoplasmic reticulumIDA11256614 
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1497985m8hsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-296576641A,m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.