Gene Page: SETDB2

Summary
GeneID  83852
Symbol  SETDB2
Synonyms  C13orf4|CLLD8|CLLL8|DKFZp586I0123|DKFZp761J1217|KMT1F
Description  SET domain, bifurcated 2
See related  HGNC:20263|MIM:607865|Ensembl:ENSG00000136169|HPRD:09712|
Locus tag  -
Gene type  protein-coding
Map location  13q14
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0016740transferase activityIEA-
GO:0008270zinc ion bindingIEA-
GO:0008168methyltransferase activityIEA-
GO:0018024histone-lysine N-methyltransferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016568chromatin modificationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-4102882941Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.