Gene Page: RASSF4

Summary
GeneID  83937
Symbol  RASSF4
Synonyms  AD037|MGC44914
Description  Ras association (RalGDS/AF-6) domain family member 4
See related  HGNC:20793|MIM:610559|Ensembl:ENSG00000107551|HPRD:15219|
Locus tag  RP11-285G1.4
Gene type  protein-coding
Map location  10q11.21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 3.028 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007165signal transductionIEA-
GO:0045786negative regulation of cell cycleIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
HMGB1DKFZp686A04236 | HMG1 | HMG3 | SBP-1high-mobility group box 1-HPRD11748221 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-153100510121A,m8hsa-miR-153UUGCAUAGUCACAAAAGUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.