Gene Page: B3GNT5

Summary
GeneID  84002
Symbol  B3GNT5
Synonyms  B3GN-T5|beta3Gn-T5
Description  UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
See related  HGNC:15684|Ensembl:ENSG00000176597|HPRD:12511|
Locus tag  -
Gene type  protein-coding
Map location  3q28
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0008378galactosyltransferase activityIEA-
GO:0016757transferase activity, transferring glycosyl groupsIEA-
GO:0008457beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl-ceramide beta-1,3-acetylglucosaminyltransferase activityIDA11384981 
GO:0008917lipopolysaccharide N-acetylglucosaminyltransferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007417central nervous system developmentIDABrain (GO term level: 6)11384981 
GO:0006486protein amino acid glycosylationTAS11384981 
GO:0009247glycolipid biosynthetic processTAS11384981 
GO:0007275multicellular organismal developmentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000139Golgi membraneIEA-
GO:0005794Golgi apparatusIEA-
GO:0005622intracellularIDA11384981 
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-30-5p157015771A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-38123832389m8hsa-miR-381UAUACAAGGGCAAGCUCUCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.