Gene Page: TOMM40L

Summary
GeneID  84134
Symbol  TOMM40L
Synonyms  FLJ12770|RP11-297K8.10|TOMM40B
Description  translocase of outer mitochondrial membrane 40 homolog (yeast)-like
See related  HGNC:25756|Ensembl:ENSG00000158882|HPRD:13354|
Locus tag  -
Gene type  protein-coding
Map location  1q23.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0005515protein bindingIEA-
GO:0008308voltage-gated anion channel activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006820anion transportIEA-
GO:0016481negative regulation of transcriptionIEA-
GO:0015031protein transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005829cytosolIEA-
GO:0005634nucleusIEA-
GO:0005739mitochondrionIEA-
GO:0005741mitochondrial outer membraneIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0043234protein complexIDA11256614 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3467357421A,m8hsa-miR-346brainUGUCUGCCCGCAUGCCUGCCUCU
miR-378143814441Ahsa-miR-378CUCCUGACUCCAGGUCCUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.