Gene Page: SYT3

Summary
GeneID  84258
Symbol  SYT3
Synonyms  DKFZp761O132|SytIII
Description  synaptotagmin III
See related  HGNC:11511|MIM:600327|Ensembl:ENSG00000213023|HPRD:08977|
Locus tag  -
Gene type  protein-coding
Map location  19q13.33
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005509calcium ion bindingIEA-
GO:0005515protein bindingIEA-
GO:0005215transporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006810transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0008021synaptic vesicleIEASynap, Neurotransmitter (GO term level: 12)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0005768endosomeIDA11256614 
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0030054cell junctionIEA-
GO:0031410cytoplasmic vesicleIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AP2A1ADTAA | AP2-ALPHA | CLAPA1adaptor-related protein complex 2, alpha 1 subunit-HPRD7791877 
SNAP25FLJ23079 | RIC-4 | RIC4 | SEC9 | SNAP | SNAP-25 | bA416N4.2 | dJ1068F16.2synaptosomal-associated protein, 25kDa-HPRD,BioGRID10692432 
SYNCRIPGRY-RBP | HNRPQ1 | NSAP1 | RP1-3J17.2 | dJ3J17.2 | hnRNP-Q | pp68synaptotagmin binding, cytoplasmic RNA interacting proteinReconstituted ComplexBioGRID10734137 
SYT3DKFZp761O132 | SytIIIsynaptotagmin IIIAffinity Capture-WesternBioGRID10531343 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-13584911A,m8hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
miR-1437379m8hsa-miR-143brainUGAGAUGAAGCACUGUAGCUCA
miR-181357363m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-5034624681Ahsa-miR-503UAGCAGCGGGAACAGUUCUGCAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.