Gene Page: NUDT22

Summary
GeneID  84304
Symbol  NUDT22
Synonyms  MGC13045
Description  nudix (nucleoside diphosphate linked moiety X)-type motif 22
See related  HGNC:28189|Ensembl:ENSG00000149761|HPRD:14434|
Locus tag  -
Gene type  protein-coding
Map location  11q13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.733 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-142-5p1319m8hsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.