Gene Page: FBN3

Summary
GeneID  84467
Symbol  FBN3
Synonyms  KIAA1776
Description  fibrillin 3
See related  HGNC:18794|MIM:608529|Ensembl:ENSG00000142449|HPRD:10538|
Locus tag  -
Gene type  protein-coding
Map location  19p13
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.474 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005488bindingIEA-
GO:0005509calcium ion bindingIEA-
GO:0005201extracellular matrix structural constituentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005578proteinaceous extracellular matrixIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3781061121Ahsa-miR-378CUCCUGACUCCAGGUCCUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.