Gene Page: PARD6G

Summary
GeneID  84552
Symbol  PARD6G
Synonyms  FLJ45701|PAR-6G|PAR6gamma
Description  par-6 partitioning defective 6 homolog gamma (C. elegans)
See related  HGNC:16076|MIM:608976|Ensembl:ENSG00000178184|HPRD:10138|
Locus tag  -
Gene type  protein-coding
Map location  18q23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0005515protein bindingIPI11260256 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007049cell cycleIEA-
GO:0051301cell divisionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005923tight junctionIEABrain (GO term level: 10)-
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CDC42CDC42Hs | G25Kcell division cycle 42 (GTP binding protein, 25kDa)-HPRD,BioGRID11260256 
PARD3ASIP | Baz | Bazooka | FLJ21015 | PAR3 | PAR3alpha | PARD3A | SE2-5L16 | SE2-5LT1 | SE2-5T2par-3 partitioning defective 3 homolog (C. elegans)Affinity Capture-WesternBioGRID12459187 
PRKCIDXS1179E | MGC26534 | PKCI | nPKC-iotaprotein kinase C, iota-HPRD,BioGRID11260256 
PRKCZPKC-ZETA | PKC2protein kinase C, zeta-HPRD,BioGRID11260256 
RAC1MGC111543 | MIG5 | TC-25 | p21-Rac1ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)-HPRD,BioGRID11260256 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-21418391845m8hsa-miR-214brainACAGCAGGCACAGACAGGCAG
miR-3203243301Ahsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.