Gene Page: COPS3

Summary
GeneID  8533
Symbol  COPS3
Synonyms  SGN3
Description  COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)
See related  HGNC:2239|MIM:604665|Ensembl:ENSG00000141030|HPRD:07262|
Locus tag  -
Gene type  protein-coding
Map location  17p11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0625 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI15861129 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001701in utero embryonic developmentIEA-
GO:0007165signal transductionTAS9535219 
GO:0009416response to light stimulusTAS9535219 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmTAS9535219 
GO:0008180signalosomeIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARAFA-RAF | ARAF1 | PKS2 | RAFA1v-raf murine sarcoma 3611 viral oncogene homolog-HPRD,BioGRID12620389 
A-RAF interacts with SGN3.BIND12620389 
ARAF (A-Raf) interacts with COPS3 (SGN3).BIND12620389 
COPS4MGC10899 | MGC15160COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)CSN4 interacts with CSN3.BIND12615944 
-HPRD9707402 |14647295 
COPS6CSN6 | MOV34-34KDCOP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)CSN6 interacts with CSN3.BIND12615944 
COPS8COP9 | CSN8 | MGC1297 | MGC43256 | SGN8COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)Co-purificationBioGRID9707402 
CSN8 interacts with CSN3.BIND12615944 
GPS1COPS1 | CSN1 | MGC71287G protein pathway suppressor 1-HPRD11114242 
IKBKGAMCBX1 | FIP-3 | FIP3 | Fip3p | IKK-gamma | IP | IP1 | IP2 | IPD2 | NEMOinhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma-HPRD,BioGRID11418127 
LRP2BPDKFZp761O0113 | FLJ44965LRP2 binding protein-HPRD12508107 
MLF1-myeloid leukemia factor 1MLF1 interacts with COPS3 (CSN3).BIND15861129 
PHYHLN1 | LNAP1 | PAHX | PHYH1 | RDphytanoyl-CoA 2-hydroxylaseAffinity Capture-MSBioGRID17353931 
RAF1CRAF | NS5 | Raf-1 | c-Rafv-raf-1 murine leukemia viral oncogene homolog 1RAF1 (C-Raf) interacts with COPS3 (SGN3).BIND12620389 
C-RAF interacts with SGN3.BIND12620389 
WDR8FLJ20430 | MGC99569WD repeat domain 8Affinity Capture-MSBioGRID17353931 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1552382441Ahsa-miR-155UUAAUGCUAAUCGUGAUAGGGG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.