Gene Page: DNAJC14

Summary
GeneID  85406
Symbol  DNAJC14
Synonyms  DNAJ|DRIP78|HDJ3|LIP6
Description  DnaJ (Hsp40) homolog, subfamily C, member 14
See related  HGNC:24581|MIM:606092|Ensembl:ENSG00000135392|HPRD:12082|
Locus tag  -
Gene type  protein-coding
Map location  12q13.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0031072heat shock protein bindingIEA-
GO:0051082unfolded protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006457protein foldingIEA-
GO:0015031protein transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005789endoplasmic reticulum membraneIEA-
GO:0005783endoplasmic reticulumIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AGTR1AG2S | AGTR1A | AGTR1B | AT1 | AT1B | AT1R | AT2R1 | AT2R1A | AT2R1B | HAT1Rangiotensin II receptor, type 1-HPRD12446598 
DRD1DADR | DRD1Adopamine receptor D1-HPRD,BioGRID11331877 |14993367 
LYSTCHS | CHS1lysosomal trafficking regulator-HPRD,BioGRID11984006 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/35128341Ahsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-221/222596602m8hsa-miR-221brainAGCUACAUUGUCUGCUGGGUUUC
hsa-miR-222brainAGCUACAUCUGGCUACUGGGUCUC
miR-495832838m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
miR-93443511A,m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.