Gene Page: CNTNAP4

Summary
GeneID  85445
Symbol  CNTNAP4
Synonyms  CASPR4|KIAA1763
Description  contactin associated protein-like 4
See related  HGNC:18747|MIM:610518|Ensembl:ENSG00000152910|HPRD:13079|
Locus tag  -
Gene type  protein-coding
Map location  16q23.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005102receptor bindingIEANeurotransmitter (GO term level: 4)-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007155cell adhesionIEA-
GO:0007165signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0030425dendriteIEAneuron, axon, dendrite (GO term level: 6)-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
APBA1D9S411E | MINT1 | X11 | X11A | X11ALPHAamyloid beta (A4) precursor protein-binding, family A, member 1-HPRD,BioGRID12093160 
CASKCAGH39 | CMG | FLJ22219 | FLJ31914 | LIN2 | MICPCH | TNRC8calcium/calmodulin-dependent serine protein kinase (MAGUK family)-HPRD,BioGRID12093160 
FBXO21DKFZp434G058 | FBX21 | FLJ90233 | KIAA0875 | MGC26682F-box protein 21-HPRD12421765 
MACF1ABP620 | ACF7 | FLJ45612 | FLJ46776 | KIAA0465 | KIAA1251 | MACF | OFC4microtubule-actin crosslinking factor 1-HPRD12421765 
RANBP10FLJ31165 | KIAA1464RAN binding protein 10-HPRD12421765 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3314854m8hsa-miR-331brainGCCCCUGGGCCUAUCCUAGAA
miR-4869096m8hsa-miR-486UCCUGUACUGAGCUGCCCCGAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.