Gene Page: CCNA2

Summary
GeneID  890
Symbol  CCNA2
Synonyms  CCN1|CCNA
Description  cyclin A2
See related  HGNC:1578|MIM:123835|Ensembl:ENSG00000145386|HPRD:00453|
Locus tag  -
Gene type  protein-coding
Map location  4q25-q31
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 1.9388 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI15890360 |17254966 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007049cell cycleIEA-
GO:0007067mitosisIEA-
GO:0007095mitotic cell cycle G2/M transition DNA damage checkpointTAS1312467 
GO:0051301cell divisionIEA-
GO:0045941positive regulation of transcriptionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0001939female pronucleusIEA-
GO:0001940male pronucleusIEA-
GO:0005634nucleusIDA16109376 
GO:0005654nucleoplasmEXP7969176 
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
BRCA1BRCAI | BRCC1 | IRIS | PSCP | RNF53breast cancer 1, early onset-HPRD,BioGRID9244350 |10373534 
CALM1CALML2 | CAMI | DD132 | PHKDcalmodulin 1 (phosphorylase kinase, delta)Reconstituted ComplexBioGRID14695896 
CDC2CDC28A | CDK1 | DKFZp686L20222 | MGC111195cell division cycle 2, G1 to S and G2 to M-HPRD10924145 
CCNA2 (Cyclin A) interacts with CDC2.BIND15674323 
The cyclin-dependent kinase CDC2 (cdc2) interacts with cyclin A2 (cyclin A).BIND8423786 
Affinity Capture-WesternBioGRID12853968 
CDC20CDC20A | MGC102824 | bA276H19.3 | p55CDCcell division cycle 20 homolog (S. cerevisiae)-HPRD,BioGRID10679238 
CDC25CCDC25cell division cycle 25 homolog C (S. pombe)-HPRD,BioGRID10864927 
CDC6CDC18L | HsCDC18 | HsCDC6cell division cycle 6 homolog (S. cerevisiae)-HPRD,BioGRID9566895 |9889196 
CDK2p33(CDK2)cyclin-dependent kinase 2Interaction between Cyclin A2 (PDB ID: 1JST_D) and CDK2 (PDB ID: 1JST_A).BIND8756328 
Interaction between CDK2 (PDB ID: 1JST_C) and Cyclin A2 (PDB ID: 1JST_B).BIND8756328 
Affinity Capture-WesternBioGRID12853968 
Interaction between Cyclin A2 (PDB ID: 1JST_D) and CDK2 (PDB ID: 1JST_C).BIND8756328 
CDK2 interacts with CCNA2 (cyclin A) to form a complex.BIND8475101 
-HPRD10924145 |11907280|11907280 
CCNA2 (cyclin A) interacts with Cdk2.BIND8662825 
Cdk2 interacts with Cyc A.BIND15469821 
Cyclin A interacts with cdk2.BIND9632134 
CDK3-cyclin-dependent kinase 3-HPRD8626584 
CDKN1ACAP20 | CDKN1 | CIP1 | MDA-6 | P21 | SDI1 | WAF1 | p21CIP1cyclin-dependent kinase inhibitor 1A (p21, Cip1)p21 interacts with cyclin A.BIND9632134 
cyclin A interacts with p21. This interaction was modeled on a demonstrated interaction between monkey cyclin A and monkey p21.BIND16009130 
CDKN1A (p21) interacts with CCNA2 (cyclin A).BIND8662825 
Affinity Capture-WesternBioGRID12947099 
CDKN1BCDKN4 | KIP1 | MEN1B | MEN4 | P27KIP1cyclin-dependent kinase inhibitor 1B (p27, Kip1)p27 interacts with Cyc A.BIND15469821 
p27 interacts with cyclin A.BIND9632134 
-HPRD,BioGRID12501191 
p27 interacts with cyclin A.BIND15652749 
CDKN1CBWCR | BWS | KIP2 | WBS | p57cyclin-dependent kinase inhibitor 1C (p57, Kip2)Affinity Capture-WesternBioGRID12947099 
CKS1BCKS1 | PNAS-16 | PNAS-18 | ckshs1CDC28 protein kinase regulatory subunit 1BAffinity Capture-WesternBioGRID11907280 
E2F1E2F-1 | RBAP1 | RBBP3 | RBP3E2F transcription factor 1E2F interacts with the CycA promoter and 5-prime UTR.BIND15306814 
-HPRD,BioGRID12501191 
E2F4E2F-4E2F transcription factor 4, p107/p130-bindingE2F4 interacts with CCNA2 promoter.BIND15782160 
E2F4 interacts with the Cyclin A promoter region.BIND10766737 
FEN1FEN-1 | MF1 | RAD2flap structure-specific endonuclease 1Affinity Capture-Western
Biochemical Activity
Reconstituted Complex
BioGRID12853968 
HERC5CEB1 | CEBP1hect domain and RLD 5-HPRD,BioGRID10581175 
HIRADGCR1 | TUP1 | TUPLE1HIR histone cell cycle regulation defective homolog A (S. cerevisiae)HIRA interacts with Cyclin ABIND11238922 
ITGB3BPCENP-R | CENPR | HSU37139 | NRIF3 | TAP20integrin beta 3 binding protein (beta3-endonexin)-HPRD,BioGRID10673397 
MYBL2B-MYB | BMYB | MGC15600v-myb myeloblastosis viral oncogene homolog (avian)-like 2-HPRD,BioGRID10871850 
ORC1LHSORC1 | ORC1 | PARC1origin recognition complex, subunit 1-like (yeast)Affinity Capture-WesternBioGRID11931757 
ORC2LORC2origin recognition complex, subunit 2-like (yeast)Affinity Capture-WesternBioGRID11931757 
PCNAMGC8367proliferating cell nuclear antigenAffinity Capture-WesternBioGRID12853968 
PTMAMGC104802 | TMSAprothymosin, alpha-HPRD11310559 
RBL1CP107 | MGC40006 | PRB1 | p107retinoblastoma-like 1 (p107)-HPRD,BioGRID1532458 |8230483 
|12439743 
RBL2FLJ26459 | P130 | Rb2retinoblastoma-like 2 (p130)-HPRD,BioGRID8253383 
p130 interacts with the Cyclin A promoter region.BIND10766737 
SKP1EMC19 | MGC34403 | OCP-II | OCP2 | SKP1A | TCEB1L | p19AS-phase kinase-associated protein 1-HPRD,BioGRID9858587 
SKP2FBL1 | FBXL1 | FLB1 | MGC1366S-phase kinase-associated protein 2 (p45)-HPRD,BioGRID9858587 
TAF1BA2R | CCG1 | CCGS | DYT3 | KAT4 | N-TAF1 | NSCL2 | OF | P250 | TAF2A | TAFII250TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa-HPRD,BioGRID9660973 
TP53FLJ92943 | LFS1 | TRP53 | p53tumor protein p53-HPRD,BioGRID10884347 
UBTFNOR-90 | UBFupstream binding transcription factor, RNA polymerase I-HPRD11698641 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-21983891Ahsa-miR-219brainUGAUUGUCCAAACGCAAUUCU
miR-3811571631Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.