Gene Page: RHBDL1

Summary
GeneID  9028
Symbol  RHBDL1
Synonyms  RHBDL|RRP
Description  rhomboid, veinlet-like 1 (Drosophila)
See related  HGNC:10007|MIM:603264|Ensembl:ENSG00000103269|HPRD:07050|
Locus tag  LA16c-313D11.5
Gene type  protein-coding
Map location  16p13.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004252serine-type endopeptidase activityIEAglutamate (GO term level: 7)-
GO:0008233peptidase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007165signal transductionTAS9662444 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005624membrane fractionTAS9662444 
GO:0016020membraneIEA-
GO:0005887integral to plasma membraneTAS9662444 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-24177183m8hsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.