Gene Page: CCDC109A

Summary
GeneID  90550
Symbol  CCDC109A
Synonyms  C10orf42|FLJ46135
Description  coiled-coil domain containing 109A
See related  HGNC:23526|Ensembl:ENSG00000156026|HPRD:10696|
Locus tag  -
Gene type  protein-coding
Map location  10q22.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 2.26 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/50614481454m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-13718271833m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-1383453521A,m8hsa-miR-138brainAGCUGGUGUUGUGAAUC
miR-324-5p153715431Ahsa-miR-324-5pCGCAUCCCCUAGGGCAUUGGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.