Gene Page: TMEM55B

Summary
GeneID  90809
Symbol  TMEM55B
Synonyms  C14orf9|DKFZp434M0519|MGC26684
Description  transmembrane protein 55B
See related  HGNC:19299|MIM:609865|Ensembl:ENSG00000165782|HPRD:12660|
Locus tag  -
Gene type  protein-coding
Map location  14q11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.047 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0016787hydrolase activityIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005765lysosomal membraneIEA-
GO:0005768endosomeIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0031902late endosome membraneIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/2063273341A,m8hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-142-3p5056m8hsa-miR-142-3pUGUAGUGUUUCCUACUUUAUGGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.