Gene Page: CRB3

Summary
GeneID  92359
Symbol  CRB3
Synonyms  -
Description  crumbs homolog 3 (Drosophila)
See related  HGNC:20237|MIM:609737|Ensembl:ENSG00000130545|HPRD:16749|
Locus tag  -
Gene type  protein-coding
Map location  19p13.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005923tight junctionIEABrain (GO term level: 10)-
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-
GO:0016324apical plasma membraneIEA-
GO:0030054cell junctionIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
INADLCipp | FLJ26982 | InaD-like | PATJInaD-like (Drosophila)-HPRD11964389 
MPP5FLJ12615 | PALS1membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)-HPRD12527193 |12771187 
PARD6APAR-6A | PAR6 | PAR6C | PAR6alpha | TAX40 | TIP-40par-6 partitioning defective 6 homolog alpha (C. elegans)-HPRD14718572 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3773541m8hsa-miR-377AUCACACAAAGGCAACUUUUGU
miR-4101611671Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.