Gene Page: DTD1

Summary
GeneID  92675
Symbol  DTD1
Synonyms  C20orf88|DUEB|HARS2|MGC119131|MGC41905|bA379J5.3|bA555E18.1|pqn-68
Description  D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)
See related  HGNC:16219|MIM:610996|Ensembl:ENSG00000125821|
Locus tag  -
Gene type  protein-coding
Map location  20p11.23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.046 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0016788hydrolase activity, acting on ester bondsIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0019478D-amino acid catabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-30-3p47531Ahsa-miR-30a-3pCUUUCAGUCGGAUGUUUGCAGC
hsa-miR-30e-3pCUUUCAGUCGGAUGUUUACAGC
miR-9158164m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.