Gene Page: TJAP1

Summary
GeneID  93643
Symbol  TJAP1
Synonyms  DKFZp686F06131|PILT|TJP4
Description  tight junction associated protein 1 (peripheral)
See related  HGNC:17949|Ensembl:ENSG00000137221|HPRD:10269|
Locus tag  RP3-337H4.1
Gene type  protein-coding
Map location  6p21.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04433 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI15263016 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005923tight junctionIEABrain (GO term level: 10)-
GO:0005794Golgi apparatusIEA-
GO:0030054cell junctionIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DLG1DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlgdiscs, large homolog 1 (Drosophila)-HPRD,BioGRID11602598 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-132/2126246311A,m8hsa-miR-212SZUAACAGUCUCCAGUCACGGCC
hsa-miR-132brainUAACAGUCUACAGCCAUGGUCG
miR-194626632m8hsa-miR-194UGUAACAGCAACUCCAUGUGGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.