Gene Page: HOMER3

Summary
GeneID  9454
Symbol  HOMER3
Synonyms  HOMER-3
Description  homer homolog 3 (Drosophila)
See related  HGNC:17514|MIM:604800|Ensembl:ENSG00000051128|HPRD:07270|
Locus tag  -
Gene type  protein-coding
Map location  19p13.11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenics, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingNAS10653696 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007216metabotropic glutamate receptor signaling pathwayTASglutamate (GO term level: 8)9808458 
GO:0006605protein targetingTAS10653696 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0045211postsynaptic membraneIEASynap, Neurotransmitter (GO term level: 5)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0005575cellular_componentND-
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DYNLL2DNCL1B | Dlc2 | MGC17810dynein, light chain, LC8-type 2Two-hybridBioGRID16189514 
FRYLDKFZp686E205 | FLJ16177 | KIAA0826FRY-likeTwo-hybridBioGRID16189514 
GRM5GPRC1E | MGLUR5 | MGLUR5A | MGLUR5B | mGlu5glutamate receptor, metabotropic 5Homer 3 interacts with GRM5 (mGluR5). This interaction was modeled on a demonstrated interaction between human Homer 3 and GRM5 from an unspecified species.BIND9808458 
HOMER1HOMER | HOMER1A | HOMER1B | HOMER1C | SYN47 | Ves-1homer homolog 1 (Drosophila)-HPRD9808458 
ITPR1INSP3R1 | IP3R | IP3R1 | SCA15 | SCA16inositol 1,4,5-triphosphate receptor, type 1in vitro
in vivo
BioGRID9808459 
RYR1CCO | MHS | MHS1 | RYDR | RYR | SKRRryanodine receptor 1 (skeletal)-HPRD,BioGRID12223488 
TRPC1HTRP-1 | MGC133334 | MGC133335 | TRP1transient receptor potential cation channel, subfamily C, member 1Affinity Capture-Western
Reconstituted Complex
BioGRID14505576 
TRPC4HTRP4 | MGC119570 | MGC119571 | MGC119572 | MGC119573 | TRP4transient receptor potential cation channel, subfamily C, member 4Affinity Capture-WesternBioGRID14505576 
TRPC5TRP5transient receptor potential cation channel, subfamily C, member 5Affinity Capture-WesternBioGRID14505576 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-203.1226232m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.