Gene Page: MAGED1

Summary
GeneID  9500
Symbol  MAGED1
Synonyms  DLXIN-1|NRAGE
Description  melanoma antigen family D, 1
See related  HGNC:6813|MIM:300224|Ensembl:ENSG00000179222|HPRD:02202|
Locus tag  -
Gene type  protein-coding
Map location  Xp11.23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.013 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
HTT0.880.88
MPRIP0.860.88
ATXN1L0.860.85
PHLPP20.860.86
KIAA02470.860.85
TGOLN20.860.86
PPP1R12B0.850.88
GFOD10.850.90
LMTK20.840.86
AC115090.10.840.85
Top 10 negatively co-expressed genes
C1orf61-0.59-0.63
GNG11-0.58-0.59
C1orf54-0.57-0.58
DBI-0.57-0.63
RHOC-0.56-0.60
SYCP3-0.53-0.54
MTCP1NB-0.52-0.53
C8orf59-0.51-0.49
AL050337.1-0.51-0.52
RPS27L-0.51-0.50
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003713transcription coactivator activityIEA-
GO:0005515protein bindingIPI15930293 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006357regulation of transcription from RNA polymerase II promoterIEA-
GO:0042981regulation of apoptosisTAS15930293 
GO:0050680negative regulation of epithelial cell proliferationIDA15930293 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-
GO:0043234protein complexIDA15930293 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AKAP8LDKFZp434L0650 | HA95 | HAP95 | NAKAP | NAKAP95A kinase (PRKA) anchor protein 8-likeAffinity Capture-MSBioGRID17353931 
ATXN10E46L | FLJ37990 | SCA10ataxin 10Affinity Capture-MSBioGRID17353931 
BAT3BAG-6 | BAG6 | D6S52E | G3HLA-B associated transcript 3Affinity Capture-MSBioGRID17353931 
BRP44LCGI-129 | dJ68L15.3brain protein 44-likeTwo-hybridBioGRID16169070 
CALML5CLSPcalmodulin-like 5Affinity Capture-MSBioGRID17353931 
CCDC59BR22 | DKFZp686K1021 | FLJ10294 | HSPC128 | TAP26coiled-coil domain containing 59Affinity Capture-MSBioGRID17353931 
COPGCOPG1 | FLJ21068coatomer protein complex, subunit gammaAffinity Capture-MSBioGRID17353931 
COPG22-COP | DKFZp761N09121 | FLJ11781coatomer protein complex, subunit gamma 2Affinity Capture-MSBioGRID17353931 
DLX4BP1 | DLX7 | DLX8 | DLX9distal-less homeobox 4-HPRD,BioGRID11084035 
DLX5-distal-less homeobox 5in vivo
Two-hybrid
BioGRID11084035 
EIF3EEIF3-P48 | EIF3S6 | INT6 | eIF3-p46eukaryotic translation initiation factor 3, subunit EAffinity Capture-MSBioGRID17353931 
EIF3JEIF3S1 | eIF3-alpha | eIF3-p35eukaryotic translation initiation factor 3, subunit JTwo-hybridBioGRID16169070 
FANCIFLJ10719 | KIAA1794Fanconi anemia, complementation group IAffinity Capture-MSBioGRID17353931 
GCN1L1GCN1 | GCN1L | KIAA0219GCN1 general control of amino-acid synthesis 1-like 1 (yeast)Affinity Capture-MSBioGRID17353931 
GPR135HUMNPIIY20G protein-coupled receptor 135Two-hybridBioGRID16169070 
HEATR1BAP28 | FLJ10359 | MGC72083HEAT repeat containing 1Affinity Capture-MSBioGRID17353931 
HEATR2FLJ20397 | FLJ25564 | FLJ31671 | FLJ39381HEAT repeat containing 2Affinity Capture-MSBioGRID17353931 
HSPB1CMT2F | DKFZp586P1322 | HMN2B | HS.76067 | HSP27 | HSP28 | Hsp25 | SRP27heat shock 27kDa protein 1Affinity Capture-MSBioGRID17353931 
IARSFLJ20736 | IARS1 | ILRS | PRO0785isoleucyl-tRNA synthetaseAffinity Capture-MSBioGRID17353931 
KIAA1967DBC-1 | DBC1KIAA1967Affinity Capture-MSBioGRID17353931 
LRPPRCCLONE-23970 | GP130 | LRP130 | LSFCleucine-rich PPR-motif containingAffinity Capture-MSBioGRID17353931 
MAGED1DLXIN-1 | NRAGEmelanoma antigen family D, 1-HPRD,BioGRID11084035 
MSX2CRS2 | FPP | HOX8 | MSH | PFM | PFM1msh homeobox 2-HPRD,BioGRID11084035 |11959851 
MTHFD1LDKFZp586G1517 | FLJ21145 | FTHFSDC1 | MTC1THFS | dJ292B18.2methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-likeAffinity Capture-MSBioGRID17353931 
NEDD8FLJ43224 | MGC104393 | MGC125896 | MGC125897 | Nedd-8neural precursor cell expressed, developmentally down-regulated 8Affinity Capture-MSBioGRID17353931 
NGFRCD271 | Gp80-LNGFR | TNFRSF16 | p75(NTR) | p75NTRnerve growth factor receptor (TNFR superfamily, member 16)Affinity Capture-WesternBioGRID12716928 
NOC2LDKFZp564C186 | FLJ35172 | NIRnucleolar complex associated 2 homolog (S. cerevisiae)Affinity Capture-MSBioGRID17353931 
NUP160DKFZp686M14102 | MGC150678 | MGC150679nucleoporin 160kDaAffinity Capture-MSBioGRID17353931 
NUP205C7orf14nucleoporin 205kDaAffinity Capture-MSBioGRID17353931 
PJA1RNF70praja 1-HPRD,BioGRID11959851 
PJA2KIAA0438 | Neurodap1 | RNF131praja 2, RING-H2 motif containing-HPRD,BioGRID11959851 
PLK1PLK | STPK13polo-like kinase 1 (Drosophila)Two-hybridBioGRID16169070 
RFX1EF-Cregulatory factor X, 1 (influences HLA class II expression)Two-hybridBioGRID16169070 
ROR2BDB | BDB1 | MGC163394 | NTRKR2receptor tyrosine kinase-like orphan receptor 2-HPRD,BioGRID12754255 
SIRT7MGC126840 | MGC126842 | SIR2L7sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae)Two-hybridBioGRID16169070 
SLC25A1CTP | SLC20A3solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1Affinity Capture-MSBioGRID17353931 
SMC3BAM | BMH | CDLS3 | CSPG6 | HCAP | SMC3L1structural maintenance of chromosomes 3Affinity Capture-MSBioGRID17353931 
SPTLC1HSAN | HSAN1 | HSN1 | LBC1 | LCB1 | MGC14645 | SPT1 | SPTIserine palmitoyltransferase, long chain base subunit 1Affinity Capture-MSBioGRID17353931 
TELO2CLK2 | DKFZp434A073 | FLJ10924 | KIAA0683 | TEL2 | c305C8.3 | hCLK2TEL2, telomere maintenance 2, homolog (S. cerevisiae)Affinity Capture-MSBioGRID17353931 
TIMM50MGC102733 | TIM50 | TIM50Ltranslocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)Affinity Capture-MSBioGRID17353931 
TRAF4CART1 | MLN62 | RNF83TNF receptor-associated factor 4TRAF4 interacts with NRAGE.BIND12023963 
UBR5DD5 | EDD | EDD1 | FLJ11310 | HYD | KIAA0896 | MGC57263ubiquitin protein ligase E3 component n-recognin 5Affinity Capture-MSBioGRID17353931 
UNC5AFLJ16449 | KIAA1976 | UNC5H1unc-5 homolog A (C. elegans)-HPRD,BioGRID12598531 
XIAPAPI3 | BIRC4 | ILP1 | MIHA | XLP2X-linked inhibitor of apoptosis-HPRD,BioGRID11546791 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-485-5p53591Ahsa-miR-485-5pAGAGGCUGGCCGUGAUGAAUUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.