Gene Page: RNF40

Summary
GeneID  9810
Symbol  RNF40
Synonyms  BRE1B|DKFZp686K191|KIAA0661|MGC13051|RBP95|STARING
Description  ring finger protein 40
See related  HGNC:16867|MIM:607700|Ensembl:ENSG00000103549|HPRD:07411|
Locus tag  -
Gene type  protein-coding
Map location  16p11.2-p11.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.01775 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0016874ligase activityIEA-
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006511ubiquitin-dependent protein catabolic processIEA-
GO:0016568chromatin modificationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005694chromosomeIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
NCBP1CBP80 | MGC2087 | NCBPnuclear cap binding protein subunit 1, 80kDaTwo-hybridBioGRID16189514 
SPRYD5MGC10977 | TRIM51SPRY domain containing 5Two-hybridBioGRID16189514 
STX1AHPC-1 | STX1 | p35-1syntaxin 1A (brain)Affinity Capture-Western
Reconstituted Complex
BioGRID12121982 
UBE2L6MGC40331 | RIG-B | UBCH8ubiquitin-conjugating enzyme E2L 6-HPRD,BioGRID12121982 
ZNF451COASTER | FLJ23421 | FLJ53246 | FLJ90693 | KIAA0576 | KIAA1702 | MGC26701 | dJ417I1.1zinc finger protein 451Two-hybridBioGRID16189514 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/2068638691Ahsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-125/351915m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-33111171Ahsa-miR-331brainGCCCCUGGGCCUAUCCUAGAA
miR-4916066m8hsa-miR-491brainAGUGGGGAACCCUUCCAUGAGGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.