Gene Page: TOX4

Summary
GeneID  9878
Symbol  TOX4
Synonyms  C14orf92|KIAA0737|LCP1|MIG7
Description  TOX high mobility group box family member 4
See related  HGNC:20161|Ensembl:ENSG00000092203|HPRD:12661|
Locus tag  -
Gene type  protein-coding
Map location  14q11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.047 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0278 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000785chromatinIEA-
GO:0005634nucleusIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-140169517011Ahsa-miR-140brainAGUGGUUUUACCCUAUGGUAG
miR-183247824841Ahsa-miR-183UAUGGCACUGGUAGAAUUCACUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.