Gene Page: SNAP91

Summary
GeneID  9892
Symbol  SNAP91
Synonyms  AP180|CALM|DKFZp781O0519|KIAA0656
Description  synaptosomal-associated protein, 91kDa homolog (mouse)
See related  HGNC:14986|MIM:607923|Ensembl:ENSG00000065609|HPRD:06391|
Locus tag  RP1-120N9.1
Gene type  protein-coding
Map location  6q14.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0030276clathrin bindingIEASynap (GO term level: 4)-
GO:0005543phospholipid bindingIEA-
GO:0005545phosphatidylinositol bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0048268clathrin coat assemblyIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0030118clathrin coatIEA-
GO:0005905coated pitIEA-
GO:0005886plasma membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
EPS15AF-1P | AF1P | MLLT5epidermal growth factor receptor pathway substrate 15-HPRD,BioGRID12807910 
OGTFLJ23071 | HRNT1 | MGC22921 | O-GLCNACO-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)-HPRD8063760 
PLCG1PLC-II | PLC1 | PLC148 | PLCgamma1phospholipase C, gamma 1-HPRD11779129 
TUBA1BK-ALPHA-1tubulin, alpha 1b-HPRD12750376 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-141/200a11481154m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-14410871093m8hsa-miR-144UACAGUAUAGAUGAUGUACUAG
miR-2211661172m8hsa-miR-22brainAAGCUGCCAGUUGAAGAACUGU
miR-25/32/92/363/367138013861Ahsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-38431371Ahsa-miR-384AUUCCUAGAAAUUGUUCAUA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.