| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 100126329 |
Name | MIR941-1 |
Synonym | MIRN941-1;microRNA 941-1;MIR941-1;microRNA 941-1 |
Definition | hsa-mir-941-1 |
Position | 20q13.33 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 100126329 |
Links to all GeneRIF Items | 100126329 |
Links to iHOP | 100126329 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>100126329 : length: 23 cacccggctgtgtgcacatgtgc |
Protein Sequence |
>100126329 : length: 3 N/A |