| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 100126333 |
Name | MIR708 |
Synonym | MIRN708|hsa-mir-708;microRNA 708;MIR708;microRNA 708 |
Definition | - |
Position | 11q14.1 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 100126333 |
Links to all GeneRIF Items | 100126333 |
Links to iHOP | 100126333 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >100126333 : length: 23 aaggagcttacaatctagctggg |
Protein Sequence | >100126333 : length: 3 N/A |