| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 100302145 |
Name | MIR1247 |
Synonym | MIRN1247|hsa-mir-1247;microRNA 1247;MIR1247;microRNA 1247 |
Definition | - |
Position | - |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 100302145 |
Links to all GeneRIF Items | 100302145 |
Links to iHOP | 100302145 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >100302145 : length: 22 acccgtcccgttcgtccccgga |
Protein Sequence | >100302145 : length: 3 N/A |