| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 100302232 |
Name | MIR1226 |
Synonym | MIRN1226|hsa-mir-1226;microRNA 1226;MIR1226;microRNA 1226 |
Definition | - |
Position | 3p21.31 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 100302232 |
Links to all GeneRIF Items | 100302232 |
Links to iHOP | 100302232 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>100302232 : length: 26 gtgagggcatgcaggcctggatgggg |
Protein Sequence |
>100302232 : length: 3 N/A |