| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406913 |
Name | MIR126 |
Synonym | MIRN126|miRNA126;microRNA 126;MIR126;microRNA 126 |
Definition | hsa-mir-126 |
Position | 9q34.3 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406913 |
Links to all GeneRIF Items | 406913 |
Links to iHOP | 406913 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406913 : length: 21 cattattacttttggtacgcg |
Protein Sequence |
>406913 : length: 3 N/A |