| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406917 |
Name | MIR129-1 |
Synonym | MIR-129b|MIRN129-1;microRNA 129-1;MIR129-1;microRNA 129-1 |
Definition | hsa-mir-129-1 |
Position | 7q32.1 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406917 |
Links to all GeneRIF Items | 406917 |
Links to iHOP | 406917 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406917 : length: 21 ctttttgcggtctgggcttgc |
Protein Sequence |
>406917 : length: 3 N/A |