| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406922 |
Name | MIR133A1 |
Synonym | MIRN133A1;microRNA 133a-1;MIR133A1;microRNA 133a-1 |
Definition | hsa-mir-133a-1 |
Position | 18q11.2 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406922 |
Links to all GeneRIF Items | 406922 |
Links to iHOP | 406922 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406922 : length: 22 tttggtccccttcaaccagctg |
Protein Sequence | >406922 : length: 3 N/A |