| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406929 |
Name | MIR138-1 |
Synonym | MIRN138-1;microRNA 138-1;MIR138-1;microRNA 138-1 |
Definition | hsa-mir-138-1 |
Position | 3p21.32 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406929 |
Links to all GeneRIF Items | 406929 |
Links to iHOP | 406929 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406929 : length: 23 agctggtgttgtgaatcaggccg |
Protein Sequence |
>406929 : length: 3 N/A |