General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 406962 |
Name | MIR186 |
Synonym | MIRN186|miR-186;microRNA 186;MIR186;microRNA 186 |
Definition | hsa-mir-186 |
Position | 1p31.1 |
Gene Type | ncRNA |
TSG scores |
Description |
TUSON ranking | N/A |
TUSON P-value | N/A |
External Links |
|
Links to Entrez Gene | 406962 |
Links to all GeneRIF Items | 406962 |
Links to iHOP | 406962 |
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406962 : length: 22 caaagaattctccttttgggct |
Protein Sequence |
>406962 : length: 3 N/A |