| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406983 |
Name | MIR200A |
Synonym | MIRN200A;microRNA 200a;MIR200A;microRNA 200a |
Definition | hsa-mir-200a |
Position | 1p36.33 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406983 |
Links to all GeneRIF Items | 406983 |
Links to iHOP | 406983 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406983 : length: 22 catcttaccggacagtgctgga |
Protein Sequence |
>406983 : length: 3 N/A |