| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406997 |
Name | MIR215 |
Synonym | MIRN215|miRNA215|mir-215;microRNA 215;MIR215;microRNA 215 |
Definition | hsa-mir-215 |
Position | 1q41 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406997 |
Links to all GeneRIF Items | 406997 |
Links to iHOP | 406997 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406997 : length: 21 atgacctatgaattgacagac |
Protein Sequence | >406997 : length: 3 N/A |