| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407000 |
Name | MIR218-1 |
Synonym | MIRN218-1|mir-218-1;microRNA 218-1;MIR218-1;microRNA 218-1 |
Definition | hsa-mir-218-1 |
Position | 4p15.31 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407000 |
Links to all GeneRIF Items | 407000 |
Links to iHOP | 407000 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407000 : length: 21 ttgtgcttgatctaaccatgt |
Protein Sequence |
>407000 : length: 3 N/A |