| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407001 |
Name | MIR218-2 |
Synonym | MIRN218-2|mir-218-2;microRNA 218-2;MIR218-2;microRNA 218-2 |
Definition | hsa-mir-218-2 |
Position | 5q34 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 407001 |
Links to all GeneRIF Items | 407001 |
Links to iHOP | 407001 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >407001 : length: 21 ttgtgcttgatctaaccatgt |
Protein Sequence | >407001 : length: 3 N/A |