| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407017 |
Name | MIR26B |
Synonym | MIRN26B|hsa-mir-26b|miR-26b;microRNA 26b;MIR26B;microRNA 26b |
Definition | - |
Position | 2q35 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407017 |
Links to all GeneRIF Items | 407017 |
Links to iHOP | 407017 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407017 : length: 21 ttcaagtaattcaggataggt |
Protein Sequence |
>407017 : length: 3 N/A |