| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407019 |
Name | MIR27B |
Synonym | MIR-27b|MIRN27B|miRNA27B;microRNA 27b;MIR27B;microRNA 27b |
Definition | hsa-mir-27b |
Position | 9q22.32 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 407019 |
Links to all GeneRIF Items | 407019 |
Links to iHOP | 407019 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >407019 : length: 22 agagcttagctgattggtgaac |
Protein Sequence | >407019 : length: 3 N/A |