| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407024 |
Name | MIR29B1 |
Synonym | MIRN29B1|miRNA29B1;microRNA 29b-1;MIR29B1;microRNA 29b-1 |
Definition | hsa-mir-29b-1 |
Position | 7q32.3 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407024 |
Links to all GeneRIF Items | 407024 |
Links to iHOP | 407024 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407024 : length: 24 gctggtttcatatggtggtttaga |
Protein Sequence |
>407024 : length: 3 N/A |