| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407029 |
Name | MIR30A |
Synonym | MIRN30A;microRNA 30a;MIR30A;microRNA 30a |
Definition | hsa-mir-30a |
Position | 6q13 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 407029 |
Links to all GeneRIF Items | 407029 |
Links to iHOP | 407029 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >407029 : length: 22 tgtaaacatcctcgactggaag |
Protein Sequence | >407029 : length: 3 N/A |