| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 407035 |
Name | MIR31 |
Synonym | MIRN31|hsa-mir-31|miR-31;microRNA 31;MIR31;microRNA 31 |
Definition | - |
Position | 9p21.3 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 407035 |
Links to all GeneRIF Items | 407035 |
Links to iHOP | 407035 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >407035 : length: 21 aggcaagatgctggcatagct |
Protein Sequence | >407035 : length: 3 N/A |