| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407040 |
Name | MIR34A |
Synonym | MIRN34A|miRNA34A|mir-34;microRNA 34a;MIR34A;microRNA 34a |
Definition | hsa-mir-34a |
Position | 1p36.22|1p36.22 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407040 |
Links to all GeneRIF Items | 407040 |
Links to iHOP | 407040 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407040 : length: 22 tggcagtgtcttagctggttgt |
Protein Sequence |
>407040 : length: 3 N/A |