| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407045 |
Name | MIR7-3 |
Synonym | MIRN7-3|hsa-mir-7-3|mir-7-3;microRNA 7-3;MIR7-3;microRNA 7-3 |
Definition | - |
Position | 19p13.3 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 407045 |
Links to all GeneRIF Items | 407045 |
Links to iHOP | 407045 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407045 : length: 23 tggaagactagtgattttgttgt |
Protein Sequence |
>407045 : length: 3 N/A |