General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 407051 |
Name | MIR9-3 |
Synonym | MIRN9-3|hsa-mir-9-3|miRNA9-3;microRNA 9-3;MIR9-3;microRNA 9-3 |
Definition | - |
Position | 15q26.1 |
Gene Type | ncRNA |
TSG scores |
Description |
TUSON ranking | N/A |
TUSON P-value | N/A |
External Links |
|
Links to Entrez Gene | 407051 |
Links to all GeneRIF Items | 407051 |
Links to iHOP | 407051 |
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>407051 : length: 23 tctttggttatctagctgtatga |
Protein Sequence |
>407051 : length: 3 N/A |