| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 4499 |
Name | MT1M |
Synonym | MT-1M|MT-IM|MT1|MT1K;metallothionein 1M;MT1M;metallothionein 1M |
Definition | metallothionein 1K|metallothionein 1Y|metallothionein-1M |
Position | 16q13 |
Gene Type | protein-coding |
|
TSG scores |
Description |
| TUSON ranking | 10892 |
TUSON P-value | 1 |
|
External Links |
|
Links to Entrez Gene | 4499 |
Links to all GeneRIF Items | 4499 |
Links to iHOP | 4499 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>4499 : length: 186 atggaccccaactgctcctgcaccactggtgtctcctgcgcctgcaccggctcctgcaag tgcaaagagtgcaaatgcacctcctgcaagaagagctgctgctcctgctgccccgtgggc tgtgccaagtgtgcccacggctgtgtctgcaaagggacgttggagaactgcagctgctgt gcctga |
Protein Sequence |
>4499 : length: 61 MDPNCSCTTGVSCACTGSCKCKECKCTSCKKSCCSCCPVGCAKCAHGCVCKGTLENCSCC A |